Antithrombin deficiency caused by SERPINC1 gene mutation in white matter lesions: A case report.

RATIONALE: White matter lesions (WMLs) are structural changes in the brain that manifest as demyelination in the central nervous system pathologically. Vasogenic WMLs are the most prevalent type, primarily associated with advanced age and cerebrovascular risk factors. Conversely, immunogenic WMLs, typified by multiple sclerosis (MS), are more frequently observed in younger patients. It is crucial to distinguish between these 2 etiologies. Furthermore, in cases where multiple individuals exhibit WMLs within 1 family, genetic testing may offer a significant diagnostic perspective. PATIENT CONCERNS: A 25-year-old male presented to the Department of Neurology with recurrent headaches. He was healthy previously and the neurological examination was negative. Brain magnetic resonance imaging (MRI) showed widespread white matter hyperintensity lesions surrounding the ventricles and subcortical regions on T2-weighted and T2 fluid-attenuated inversion recovery images, mimicking immunogenic disease-MS. DIAGNOSES: The patient was diagnosed with a patent foramen ovale, which could explain his headache syndrome. Genetic testing unveiled a previously unidentified missense mutation in the SERPINC1 gene in the patient and his father. The specific abnormal laboratory finding was a reduction in antithrombin III activity, and the decrease may serve as the underlying cause for the presence of multiple intracranial WMLs observed in both the patient and his father. INTERVENTIONS: The patient received percutaneous patent foramen ovale closure surgery and took antiplatelet drug recommended by cardiologists and was followed up for 1 month and 6 months after operation. OUTCOMES: While the lesions on MRI remain unchanging during follow-up, the patient reported a significant relief in headaches compared to the initial presentation. LESSONS: This case introduces a novel perspective on the etiology of cerebral WMLs, suggesting that hereditary antithrombin deficiency (ATD) could contribute to altered blood composition and may serve as an underlying cause in certain individuals with asymptomatic WMLs.

[Phenotypic and genetic analysis of a Chinese pedigree affected with Hereditary antithrombin deficiency due to a novel variant of SERPINC1 gene].

OBJECTIVE: To analyze the clinical phenotype and genetic characteristics of a Chinese pedigree affected with Hereditary antithrombin deficiency. METHODS: A pedigree diagnosed at the the Second Affiliated Hospital of Wenzhou Medical University, Yuying Children's Hospital in June, 2020 was selected as the study subject. Plasma prothrombin time (PT), activated partial thromboplastin time (APTT), fibrinogen (FIB), and thrombin time (TT) of the probands and their pedigree members were determined using a STA-R automatic coagulation analyzer. Antithrombin activity (AT: A) and antithrombin antigen (AT: Ag) in plasma were determined with chromogenic substrate and immunonephelometry assays. All exons and flanking sequences of the anticoagulant protein gene SERPINC1 were amplified by PCR and subjected to Sanger sequencing. Candidate variants were verified with bioinformatic tools (PolyPhen-2, SIFT, Mutation Taster and PYMOL) to explore their effect on the function and structural conformation of the protein. RESULTS: The probands (II-2, II-10), their brother (II-5) and sons (III-1, III-8) had shown normal PT, APTT, FIB, and TT, but significantly decreased AT: A and AT: Ag, with their levels being 34%, 57%, 56%, 48%, 53% and 13.51 mg/dL, 13.44 mg/dL, 18.39 mg/dL, 17.36 mg/dL, 17.71 mg/dL, respectively. The remaining pedigree members had normal values. Sanger sequencing revealed that the probands and all affected pedigree members had harbored a heterozygous c.851T>C (p.Met284Thr) missense variant in exon 5 of the SERPINC1 gene. Bioinformatic analysis and simulation suggested that the variant has resulted in alteration of hydrogen bonds at the c.851 position, which may affect the structure of the protein. Based on the guidelines from the American College of Medical Genetics and Genomics (ACMG), the variant was classified as pathogenic (PS1+PM1+PM5+PP1+PP4). CONCLUSION: The probands and other affected members were all diagnosed with type I hereditary AT deficiency, for which the c.851T>C (p.Met284Thr) variant of the SERPINC1 gene may be accountable.

Clinical and functional characterization of rare compound heterozygous mutations in the SERPINC1 gene causing severe thrombophilia.

INTRODUCTION: Hereditary antithrombin (AT) deficiency is a rare autosomal dominant disorder with significant clinical heterogeneity. In the study, we identified a patient with AT deficiency caused by compound heterozygous mutations in the SERPINC1 gene. METHODS: A total of 9 individuals from three generations were investigated. The mutations were identified by direct sequencing of SERPINC1. Multiple in silico tools were programmed to predict the conservation of mutations and the effect on the AT structure. The coagulation state was evaluated by the thrombin generation assay. Recombinant AT was overexpressed in HEK293T cells; the mRNA level was determined using RT-qPCR. Western blotting, ELISA, and immunocytofluorescence were applied to characterize the recombinant AT protein. RESULTS: The proband was a 26-year-old male who experienced recurrent venous thrombosis. He presented the type I deficiency with 33 % AT activity and a synchronized decrease in AT antigen. Genetic screening revealed that he carried a heterozygous c.318_319insT (p.Asn107*) in exon 2 and a heterozygous c.922G > T (p.Gly308Cys) in exon 5, both of which were completely conserved in homologous species and resulted in enhanced thrombin generation capability. Hydrophobicity analysis suggested that the p.Gly308Cys mutation may interfere with the hydrophobic state of residues 307-313. In vitro expression studies indicated that the levels of the recombinant protein AT-G308C decreased to 46.98 % ± 2.94 % and 41.35 % ± 1.48 % in transfected cell lysates and media, respectively. After treatment with a proteasome inhibitor (MG132), the quantity of AT-G308C protein in the cytoplasm was replenished to a level comparable to that of the wild type. The mRNA level of AT-N107* was significantly reduced and the recombinant protein AT-N107* was not detected in either the lysate or the culture media. CONCLUSION: These two mutations were responsible for the AT defects and clinical phenotypes of the proband. The p.Gly308Cys mutation could lead to proteasome-dependent degradation of the AT protein in the cytoplasm by altering local residue hydrophobicity. The c.318_319insT could eliminate aberrant transcripts by triggering nonsense-mediated mRNA degradation. Both mutations resulted in type I AT deficiency.

Functional analysis of two abnormal antithrombin proteins with different intracellular kinetics.

INTRODUCTION: Hereditary antithrombin (AT) deficiency type I causes venous thrombosis due to decreased levels of AT antigen in the blood. We identified one novel and one known abnormal variant in two unrelated Japanese families with venous thrombosis. In this study, we analyzed the mechanism by which these abnormal variants cause type I AT deficiency. MATERIALS AND METHODS: Wild-type and variant AT expression vectors were constructed and transiently expressed in human embryonic kidney 293 cells, and AT antigen levels and N-glycosylation of cell lysates and culture medium were evaluated by western blot analysis. Subcellular co-localization of AT was also examined using confocal microscopy, and chase experiments with cycloheximide and MG132 were performed to investigate the degradation pathway of AT variants. RESULTS: Genetic analysis identified a novel variant, c.613delC (p.Leu205Trpfs⁎79), and the known variant c.283T>C (p.Tyr95His). These AT variants exhibited significantly reduced extracellular secretion compared with the wild-type; N-glycosylation of the AT protein was normal. Co-localization analysis suggested that the transport of these abnormal AT proteins to the Golgi apparatus was impaired. The c.613delC variant was degraded early by the proteasome, suggesting that the c.283T>C variant is stored in the endoplasmic reticulum (ER). CONCLUSIONS: The AT variants identified here synthesize abnormal AT proteins that exhibit suppressed secretion and impaired transport from the ER to the Golgi apparatus. These results provide clues that could help elucidate the mechanism of type I AT deficiency and facilitate therapy development.

Impact of Increased Activated Protein-C Resistance, Decreased Antithrombin III Activity and Hypocomplementemia on the Gestational Outcomes of Pregnancies with MTHFR Polymorphisms.

OBJECTIVE: To evaluate the impact of increased Activated Protein C (APC) resistance, decreased antithrombin III activity and hypocomplementemia on the pregnancy outcomes of the patients with methylentetrahydrofolate reductase (MTHFR) polymorphisms. METHODS: This study was composed of 83 pregnancies with MTHFR polymorphisms. Increased APC resistance, decreased antithrombin III activity and hypocomplementemia were accepted as risk factors for poor gestational outcome. RESULTS: Having at least one risk factor resulted in significantly higher rates of "APGAR score of<7" at the first ten minutes (p=0.009). Composite adverse outcome rate was also higher in patients with at least one of the defined risk factors despite lack of statistical significance (p=0.241). Rate of newborn with an "APGAR score of<7" at first ten minutes was significantly higher at patients with hypocomplementemia (p=0.03). CONCLUSION: Hypocomplementemia is a risk factor for poor gestational outcome in pregnancies with MTHFR polymorphisms.

Human induced pluripotent stem cells derived from a patient with a mutation of SERPINC1 c.236G>A (p.R79H).

Mutation of SERPINC1 is related to the incidence of Inherited antithrombin (AT) deficiency. In this study, we generated a human induced pluripotent stem cell (iPSC) line from peripheral blood mononuclear cells of a patient with a mutation of SERPINC1 c.236G>A (p.R79H). The generated iPSCs express pluripotent cell markers with no mycoplasma contamination. Besides, it has a normal female karyotype and could differentiate into all three germ layers in vitro.

Antithrombin, Protein C, and Protein S: Genome and Transcriptome-Wide Association Studies Identify 7 Novel Loci Regulating Plasma Levels.

BACKGROUND: Antithrombin, PC (protein C), and PS (protein S) are circulating natural anticoagulant proteins that regulate hemostasis and of which partial deficiencies are causes of venous thromboembolism. Previous genetic association studies involving antithrombin, PC, and PS were limited by modest sample sizes or by being restricted to candidate genes. In the setting of the Cohorts for Heart and Aging Research in Genomic Epidemiology consortium, we meta-analyzed across ancestries the results from 10 genome-wide association studies of plasma levels of antithrombin, PC, PS free, and PS total. METHODS: Study participants were of European and African ancestries, and genotype data were imputed to TOPMed, a dense multiancestry reference panel. Each of the 10 studies conducted a genome-wide association studies for each phenotype and summary results were meta-analyzed, stratified by ancestry. Analysis of antithrombin included 25 243 European ancestry and 2688 African ancestry participants, PC analysis included 16 597 European ancestry and 2688 African ancestry participants, PSF and PST analysis included 4113 and 6409 European ancestry participants. We also conducted transcriptome-wide association analyses and multiphenotype analysis to discover additional associations. Novel genome-wide association studies and transcriptome-wide association analyses findings were validated by in vitro functional experiments. Mendelian randomization was performed to assess the causal relationship between these proteins and cardiovascular outcomes. RESULTS: Genome-wide association studies meta-analyses identified 4 newly associated loci: 3 with antithrombin levels (GCKR, BAZ1B, and HP-TXNL4B) and 1 with PS levels (ORM1-ORM2). transcriptome-wide association analyses identified 3 newly associated genes: 1 with antithrombin level (FCGRT), 1 with PC (GOLM2), and 1 with PS (MYL7). In addition, we replicated 7 independent loci reported in previous studies. Functional experiments provided evidence for the involvement of GCKR, SNX17, and HP genes in antithrombin regulation. CONCLUSIONS: The use of larger sample sizes, diverse populations, and a denser imputation reference panel allowed the detection of 7 novel genomic loci associated with plasma antithrombin, PC, and PS levels.

Impact of SERPINC1 mutation on thrombotic phenotype in children with congenital antithrombin deficiency-first analysis of the International Society on Thrombosis and Haemostasis pediatric antithrombin deficiency database and biorepository.

BACKGROUND: The natural history and genotype-phenotype correlation of congenital antithrombin (AT) deficiency in children are unknown. OBJECTIVES: To describe the clinical presentation of congenital AT deficiency in children and evaluate its correlation to specific mutations in SERPINC1. METHODS: In 2017, a prospective pediatric database and DNA biorepository for congenital AT deficiency was established. During the pilot phase, the database was opened at 4 tertiary care centers in Canada and US. Approval from research ethics board was obtained at each participating center. Written consent/assent was obtained from guardians/subjects who met eligibility. Demographic/clinical data were uploaded into a database. DNA extraction and SERPINC1 sequencing were centralized for US centers. Standard statistical methods were used to summarize parameters. Probability of VTE-free survival was assessed using the Kaplan-Meier method. RESULTS: Overall, 43 participants (25 females) from 31 unique kindreds were enrolled. Median age (range) at enrollment was 14.8 years (1-21 years). Median AT activity was 52% (24%-87%), and median AT antigen (n = 20) was 55% (38%-110%). Nineteen (44%) participants had a history of venous thromboembolism (VTE). Median age at VTE diagnosis was 12.8 years (0.1-19.2 years). SERPINC1 sequencing was completed for 31 participants and 21 unique mutations were identified, including 5 novel variants. Probability of 5-year VTE-free survival (95% CI) for carriers of missense mutations (92.0% [95% CI: 71.6%-97.9%]) was significantly higher compared with carriers of null mutations (66.7% [95% CI: 19.5%-90.4%]); p = .0012. CONCLUSION: To our knowledge, this is the first pediatric study to document a severe thrombotic phenotype in carriers of null mutations in SERPINC1, when compared with carriers of missense mutations; underscoring the importance of genetic testing.

Identification and functional analysis of three novel genetic variants resulting in premature termination codons in three unrelated patients with hereditary antithrombin deficiency.

Hereditary antithrombin (AT) deficiency is an autosomal dominant inherited thrombophilia. In three pedigrees of hereditary type I AT deficiency, we identified novel variants c.126delC (p.Lys43Serfs*7), c.165C > G (p.Tyr55*), and c.546delA (p.Lys182Asnfs*102) in the open reading frame encoding AT in each patient. Each of these aberrant variants leads to premature termination of AT protein synthesis. To investigate whether these abnormal variants are involved in the pathogenesis of type I AT deficiency, we analyzed the function of these variants in HEK293 cells. Results of western blot analysis and immunofluorescence microscopy showed that all abnormal variants were expressed intracellularly, but p.Lys43Serfs*7 and p.Tyr55* protein were aggregated in the cells. These three variants were not detected in the spent culture medium, indicating that these novel variants affect protein secretion. In summary, we suggest that these variants in the AT-encoding gene are translated in the cell, but form abnormal proteins that form aggregates and/or inhibit secretion. These results provide insight into novel mechanisms of type I AT deficiency and potential therapies for the condition.

Assessment of breast cancer progression and metastasis during a hypercoagulable state induced by silencing of antithrombin in a xenograft mouse model.

Local coagulation activation has been shown to impact both primary tumor growth and metastasis in mice. It is well known that components of the blood clotting cascade such as tissue factor and thrombin play a role in tumor progression by activating cellular receptors and local formation of fibrin. However, whether venous thromboembolism (VTE) or a hypercoagulable state has a direct impact on cancer progression is unknown. Here we have combined an orthotopic murine breast cancer model, using female Nod-SCID mice, with siRNA-mediated silencing of antithrombin (siAT) leading to the induction of a systemic hypercoagulable state. We show that, compared to control siRNA-treated (not experiencing a hypercoagulable state) tumor-bearing mice, siAT treated tumor-bearing mice do not show enhanced tumor growth nor enhanced metastasis. We conclude that, in this murine model for hypercoagulability, induction of a hypercoagulable state does not contribute to breast cancer progression.

Inherited antithrombin deficiency caused by a mutation in the SERPINC1 gene: A case report.

RATIONALE: Inherited antithrombin deficiency (ATD) is a major cause of thrombotic deficiency. Genetic testing is of great value in the diagnosis of hereditary thrombophilia. Herein, we report a case of inherited ATD admitted to our hospital. We include the results of genealogy and discuss the significance of genetic testing in high-risk groups of hereditary thrombophilia. PATIENT CONCERNS: A 16-year-old male patient presented with chest tightness, shortness of breath, wheezing, and intermittent fever (up to 39 °C) after strenuous exercise for 2 weeks. He also had a cough with white sputum with a small amount of bright red blood in the sputum and occasional back pain. DIAGNOSES: The blood tests showed that the patient's antithrombin III concentration and activity were both significantly reduced to 41% and 43.2%, respectively. Enhanced chest computed tomography scans showed pulmonary infarction in the lower lobe of the right lung with multiple embolisms in the bilateral pulmonary arteries and branches. Lower vein angiography revealed a contrast-filling defect of the inferior vena cava and left common iliac vein. Thrombosis was considered as a differential diagnosis. His father and his uncle also had a history of thrombosis. The patient was diagnosed with inherited ATD. Further, peripheral venous blood samples of the family members were collected for whole-exome gene sequencing, and Sanger sequencing was used to verify the gene mutation site in the family. The patient and his father had a SERPINC1 gene duplication mutation: c.1315_1345dupCCTTTCCTGGTTTTTAAGAGAAGTTCCTC (NM000488.4). INTERVENTIONS: An inferior vena cava filter was inserted to avoid thrombus shedding from the lower limbs. Urokinase was injected intermittently through the femoral vein cannula for thrombolysis. Heparin combined with warfarin anticoagulant therapy was sequentially administered. After reaching the international normalized ratio, heparin was discontinued, and oral warfarin anticoagulant therapy was continued. After discharge, the patient was switched to rivaroxaban as oral anticoagulation therapy. OUTCOMES: The patient's clinical symptoms disappeared. reexamination showed that the thrombotic load was less than before, and the inferior vena cava filter was then removed. LESSONS: By this report we highlight that gene detection and phenotypic analysis are important means to study inherited ATD.

Full-length antithrombin frameshift variant with aberrant C-terminus causes endoplasmic reticulum retention with a dominant-negative effect.

Antithrombin, a major endogenous anticoagulant, is a serine protease inhibitor (serpin). We characterized the biological and clinical impact of variants involving C-terminal antithrombin. We performed comprehensive molecular, cellular, and clinical characterization of patients with C-terminal antithrombin variants from a cohort of 444 unrelated individuals with confirmed antithrombin deficiency. We identified 17 patients carrying 12 C-terminal variants, 5 of whom had the p.Arg445Serfs*17 deletion. Five missense variants caused qualitative deficiency, and 7, including 4 insertion-deletion variants, induced severe quantitative deficiency, particularly p.Arg445Serfs*17 (antithrombin <40%). This +1 frameshift variant had a molecular size similar to that of WT antithrombin but possessed a different C-terminus. Morphologic and cotransfection experiments showed that recombinant p.Arg445Serfs*17 was retained at the endoplasmic reticulum and had a dominant-negative effect on WT antithrombin. Characterization of different 1+ frameshift, aberrant C-terminal variants revealed that protein secretion was determined by frameshift site. The introduction of Pro441 in the aberrant C-terminus, shared by 5 efficiently secreted variants, partially rescued p.Arg445Serfs*17 secretion. C-terminal antithrombin mutants have notable heterogeneity, related to variant type and localization. Aberrant C-terminal variants caused by 1+ frameshift, with similar size as WT antithrombin, may be secreted or not, depending on frameshift site. The severe clinical phenotypes of these genetic changes are consistent with their dominant-negative effects.

First Report of an α Chain Variant [Hb Coombe Park (HBA2: c.382A>G)] from India, Coinherited with a Novel SERPINC1 Gene Mutation: A Double Whammy?

Coinheritance of a high oxygen affinity structural hemoglobin (Hb) variant along with a thrombophilia marker is a rare occurrence. This may lead to a multi fold increase in the risk of thrombosis in patients. We report here a first case of Hb Coombe Park (HBA2: c.382A>G; p.Lys128Glu) from India, coinherited with a novel mutation (c.839C>G; p.Ser280Ter) on the SERPINC1 gene. This coinheritance has not been reported before. Though the patient is presently asymptomatic, identification of these variants will help in genetic counseling and to decide the future course of action in case of any clinical complications.

Two SERPINC1 variants affecting N-glycosylation of Asn224 cause severe thrombophilia not detected by functional assays.

Antithrombin deficiency, the most severe congenital thrombophilia, might be underestimated, as some pathogenic variants are not detected by routine functional methods. We have identified 2 new SERPINC1 variants, p.Glu227Lys and p.Asn224His, in 4 unrelated thrombophilic patients with early and recurrent thrombosis that had normal antithrombin activity. In one case, the mutation was identified by whole genome sequencing, while in the 3 remaining cases, the mutation was identified by sequencing SERPINC1 based on a single functional positive finding supporting deficiency. The 2 variants shared a common functional defect, an impaired or null N-glycosylation of Asn224 according to a eukaryotic expression model. Carriers had normal anti-FXa or anti-FIIa activities but impaired anti-FVIIa activity and a detectable loss of inhibitory function when incubating the plasma for 1 hour at 41°C. Moreover, the ß glycoform of the variants, lacking 2 N-glycans, had reduced secretion, increased heparin affinity, no inhibitory activity, and a potential dominant-negative effect. These results explain the increased thrombin generation observed in carriers. Mutation experiments reflected the role that Lysine residues close to the N-glycosylation sequon have in impairing the efficacy of N-glycosylation. Our study shows new elements involved in the regulation of N-glycosylation, a key posttranslational modification that, according to our results, affects folding, secretion, and function, providing new evidence of the pathogenic consequence of an incorrect N-glycosylation of antithrombin. This study supports that antithrombin deficiency is underestimated and encourages the development of new functional and genetic tests to diagnose this severe thrombophilia.

[Clinical manifestations and gene analysis of 18 cases of hereditary protein S deficiency].

Objective: To analyze the clinical manifestations and molecular pathogenesis of 18 patients with inherited protein S (PS) deficiency. Methods: Eighteen patients with inherited PS deficiency who were admitted to the Institute of Hematology & Blood Diseases Hospital from June 2016 to February 2019 were analyzed: activity of protein C (PC) and antithrombin (AT) , PS activity were measured for phenotype diagnosis; high throughput sequencing (HTS) was used for screening of coagulation disease-related genes; Sanger sequencing was used to confirm candidate variants; Swiss-model was used for three-dimensional structure analysis. Results: The PS:C of 18 patients ranged from 12.5 to 48.2 U/dL. Among them, 16 cases developed deep vein thrombosis, including 2 cases each with mesenteric vein thrombosis and cerebral infarction, and 1 case each with pulmonary embolism and deep vein thrombosis during pregnancy. A total of 16 PROS1 gene mutations were detected, and 5 nonsense mutations (c.134_162del/p.Leu45*, c.847G>T/p.Glu283*, c.995_996delAT/p.Tyr332*, c.1359G> A/p.Trp453*, c.1474C>T/p.Gln492*) , 2 frameshift mutations (c.1460delG/p.Gla487Valfs*9 and c.1747_1750delAATC/p.Asn583Wfs*9) and 1 large fragment deletion (exon9 deletion) were reported for the first time. In addition, the PS:C of the deep vein thrombosis during pregnancy case was 55.2 U/dL carrying PROC gene c.565C>T/p.Arg189Trp mutation. Conclusion: The newly discovered gene mutations enriched the PROS1 gene mutation spectrum which associated with inherited PS deficiency.

Modulation of HIV Replication in Monocyte-Derived Macrophages (MDM) by Host Antiviral Factors Secretory Leukocyte Protease Inhibitor and Serpin Family C Member 1 Induced by Steroid Hormones.

The impact of steroid hormones estrogen and progesterone on human immunodeficiency virus type 1 (HIV-1) replication is well documented. However, the exact mechanism involved in the regulation of HIV-1 replication by estrogen and progesterone is still unclear. In the present study, we wanted to elucidate the molecular mechanisms underlying the modulation of HIV-1 replication by estrogen and progesterone. To achieve this goal, we used real-time quantitative PCR arrays (PCR arrays) to identify differentially expressed host genes in response to hormone treatments that are involved in antiviral responses. Our in vitro results suggest that treatment with high doses of estrogen and progesterone promotes the expression of host antiviral factors Secretory leukocyte protease inhibitor (SLPI) and Serpin family C member 1 (SERPIN C1) among others produced in response to HIV-1 infection. SLPI is an enzyme that inhibits human leukocyte elastase, human cathepsin G, human trypsin, neutrophil elastase, and mast cell chymase. SERPIN C1 is a plasma protease inhibitor that regulates the blood coagulation cascade by the inhibition of thrombin and other activated serine proteases of the coagulation system. A dose dependent downmodulation of HIV-1 replication was observed in monocyte-derived macrophages (MDMs) pre-treated with the two proteins SLPI and SERPIN C1. Further investigations suggests that the host antiviral factors, SLPI and SERPIN C1 act at the pre-integration stage, inhibiting HIV-1 viral entry and leading to the observed downmodulation of HIV-1 replication. Our studies would help identify molecular mechanisms and pathways involved in HIV-1 pathogenesis.